coronavirus hku1 infection in the united states

  • 10 min read
  • Apr 14, 2019

Figure - Coronavirus HKU1 Infection in the United States - Volume ...
Figure – Coronavirus HKU1 Infection in the United States – Volume …

Warning:
NCBI web site requires JavaScript to function.

* Case Western Reserve University School of Medicine, Cleveland, Ohio, USA;

† Yale University School of Medicine, New Haven, Connecticut, USA

† Yale University School of Medicine, New Haven, Connecticut, USA

† Yale University School of Medicine, new Haven, Connecticut, USA

† Yale University School of Medicine, new Haven, Connecticut, USA

in 2005, coronavirus new man, HCoV-HKU1, identified in Hong Kong. We screened respiratory specimens collected from December 16, 2001, until December 15, 2002 of children <5 years who tested negative for the virus respiratory syncytial, parainfluenza virus, influenza virus, and adenovirus for HCoV-HKU1 by chain transcription-polymerase reverse reaction , Overall, 1,048 respiratory specimens from 851 children tested, and children 9 HCoV-HKU1-positive (1%) were identified, two of which have two positive specimens. Children who have an infection HCoV-HKU1 have good evidence of upper respiratory tract infection or lowering or both. Two patients have the disease outside the respiratory tract. HCoV-HKU1 identified from December 2001 to February 2002. The sequence analysis showed that a single strain in circulation. HCoV-HKU1 therefore the possibility of circulating in the United States and is associated with upper respiratory tract disease and bottom.

lower respiratory tract diseases accounted ≈4 million deaths per year worldwide (). Viruses such as influenza virus, respiratory syncytial virus (RSV) and parainfluenza virus responsible for many of these respiratory tract infections. However, a significant proportion of respiratory diseases, no pathogen identified ().

coronavirus (CoV) to infect a variety of mammals and birds, causing diseases of the respiratory, gastrointestinal, and central nervous system. The virus can be transmitted from species to species (). In humans, CoV has been associated with upper respiratory tract infections community acquired (). Human COV (HCoV) have also been implicated in outbreaks of diarrhea and central nervous system demyelinating disorders, although this data is controversial (,). Research and identification of HCoV has been hampered by the difficulty in spreading viruses in vitro.

Identification CoV related severe acute respiratory syndrome in 2003 sparked renewed interest in the study of HCoV (), and four previously unknown HCoV subsequently been found. HCoV-NL63, HCoV-NL, and the New Haven coronavirus (HCoV-NH) are closely related group I CoV and the possibility of a strain of the same species of virus (-). HCoV-NL63 and HCoV-NL initially identified by cell culture techniques, whereas HCoV-NH is found by using reactive CoV broad molecular probes. The virus is linked identified in children and adults with respiratory diseases. HCoV-NH was found in 8.8% of children <5 years specimens initially tested negative for RSV, influenza virus, parainfluenza virus, and adenovirus (). Furthermore, the newly discovered virus may be the cause of the disease outside the respiratory tract. In a case-control study, HCoV-NH were found to be associated with Kawasaki disease (), although this data is controversial (,).

In 2005, Woo et al. reported a new group II CoV, HCoV-HKU1 appointed, of a man 71 years with pneumonia () had just returned to Hong Kong from Shenzhen, China. As in the invention of HCoV-NH (), the virus is detectable with molecular probes. Although HCoV-HKU1 growth in some cell lines do not succeed, the complete genome sequence was obtained. Phylogenetic analysis showed that this new group II CoV closely related to the mouse hepatitis virus and different from HCoV-OC43, the only other known group II HCoV. Screening of 400 nasopharyngeal aspiration by reverse transcription-polymerase chain reaction (RT-PCR) with primers specific HCoV-HKU1 show more HCoV-HKU1 1 isolates from a woman 35 years old with pneumonia. After the original report, HCoV-HKU1 identified in 10 patients in the northern part of Australia (). respiratory samples were collected between May and August (winter in Australia) and screened by RT-PCR with both primary HKU1 nonspecific and specific CoV. Most samples HCoV-HKU1-positive came from children in the winter. However, seasonal and geographic distribution of the virus is still unclear. To resolve this issue, we sought to determine whether HCoV-HKU1 circulated in New Haven, Connecticut, and to determine the clinical characteristics associated with HCoV-HKU1 infection in infants and children.

nasopharyngeal swabs and aspirations articulated to the clinical virology laboratory at Yale-New Haven Hospital on December 16, 2001, until December 15, 2002 for the diagnosis of respiratory viruses were originally tested for RSV, parainfluenza virus (types 1-3) , influenza A and B virus, and adenovirus by direct immunofluorescence assay. respiratory specimens were screened for human metapneumovirus () and HCoV-NH () by RT-PCR. The specimens came from the emergency department, inpatient wards, intensive care units, and primary care outpatient clinics affiliated hospital and left to the discretion of the medical team. Clinical specimens from children <5 years who tested negative by indirect immunofluorescence assay was tested for HCoV-HKU1 as described below. Collection of specimens and clinical data have been approved by the Yale University Human Investigations Committee and in accordance with the regulations of Health Insurance Portability and Accountability Act.

RNA from respiratory specimens respectively extracted by QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol. random hexamer primer oligonucleotides synthesized by the laboratory, Department of Pathology, Yale University School of Medicine, used to make a cDNA library for each specimen. Reverse transcription reaction carried out by MuMLV RT (New England Biolabs, Beverly, MA, USA), according to the manufacturer’s specifications. Each cDNA then screened for the presence of HCoV-HKU1 by polymerase chain reaction with Hotstar Taq polymerase (Qiagen) according to manufacturer’s specifications. Primers used to screen respiratory specimens identical to that described by Woo et al. (). The forward primer, 5’GGTTGGGATTATCCTAAATGTGA and reverse primer, 5’CCATCATCACTCAAAATCATCATA, generate amplicons corresponding to nucleotides 15409-15848 of HCoV-HKU1 replicase 1B gene (GenBank accession no.) And produce an amplicon of 439 bp. Amplification cycles were as follows: 95 ° C for 15 minutes; followed by 40 cycles of 94 ° C for 1 min, 55 ° C for 1 minute, and 72 ° C for 1 minute; and finish with a final extension cycle of 72 ° C for 10 minutes. Each set of transcription and polymerase chain reaction otherwise contained appropriate negative controls. Sequencing is done in Biosystems 3730 DNA Analyzer Applied XL (Foster City, CA, USA) in W.M. Keck Biotechnology Resource Laboratory at Yale University School of Medicine.

The medical records of all children HCoV-HKU1 positive reviews. The demographic data, medical history, and results of clinical research and laboratory examinations are recorded on a standard collection form. Yale University Human Investigations Committee approved the collection of specimens and clinical data.

From December 16, 2001, until December 15, 2002 1,048 respiratory specimens from 851 children were tested by RT-PCR for HCoV-HKU1. Specimens of 9 children (1%) tested positive for HCoV-HKU1. Specimens of these children tested negative for RSV, parainfluenza virus (types 1-3), influenza A and B virus, and adenovirus by direct immunofluorescence assay as well as human metapneumovirus and HCoV-NH by RT-PCR. Two children have two specimens that tested positive for HCoV-HKU1. For each of the two children, a positive specimens collected <10 days apart. Children who are infected specimens tested positive for HCoV-HKU1 have good clinical evidence of upper respiratory tract infection or lowering or both (). The most common clinical findings are rhinorrhea (100%), cough (67%), fever (67%), and abnormal breath sounds on auscultation (44%). Hypoxia (oxygen saturation <90%) was observed in only one patient. Chest radiographs were obtained for 4 patients, all had abnormal findings included peribronchial cuffing, atelectasis, hyperinflation, or infiltrates. One patient (patient 3) had respiratory decompensation requiring ventilatory support and was admitted to the pediatric intensive care unit. This patient had no history of the underlying disease, not premature, and 1 month of age at the time of specimen collection

* M, male .; F, female; RAD, reactive airway disease; NH, was not hospitalized;ALTE, apparent life-threatening events; LFT, liver function tests (aspartate aminotransferase 238 U / mL, ALT 373 U / mL, alkaline phosphatase 406 U / mL, bilirubin [total / direct] 0:15 / 0:05 mg / dL). † Two respiratory specimens tested positive for human coronavirus HKU1. ‡ patients required mechanical ventilation and the entrance to the pediatric intensive care unit.

Two of the patients had evidence of disease outside the respiratory tract. One patient (patient 1) was treated in hospital for new onset seizures. Examination for infections of the central nervous system, including lumbar puncture and head magnetic resonance imaging, which is unrevealing. Although the diagnosis of febrile seizures remains possible, there is no evidence of fever were reported by the mother or take notes during a hospital stay. A second patient (patient 7) hospitalized with hepatitis. This patient had undergone a liver transplant three months prior to admission. Including immunosuppressive drugs tacrolimus and prednisolone. Patients also received ganciclovir for prophylaxis of cytomegalovirus. The emergence of abnormal liver enzyme levels occurred a few days after the onset of respiratory symptoms and after collection of respiratory specimens that tested positive for HCoV-HKU1. There is no evidence of abnormal liver function is detected (both prothrombin time and partial thromboplastin time were within the normal range). Serologic tests for viral hepatitis A, B, and C were negative. A liver biopsy specimen showed no evidence of rejection. Serum liver enzyme levels slowly decline during hospitalization. No intervention (eg, changes in immunosuppressive therapy) is performed.

All HCoV-HKU1 infections occur during a period of 7 weeks from December 2001 to February 2002 (). HCoV-HKU1 sample-positive accounted for 5% of the samples were screened during that period. No HCoV-HKU1 isolates positive was detected in specimens collected in the remainder of the study period.

weekly distribution of human coronavirus (HCoV) -HKU1 infection in children <5 years old, December 16, 2001, until December 15, 2002 New Haven, Connecticut. Weekly distribution HCoV-HKU1 isolates displayed as a gray bar (left axis). The number of samples collected by the week indicated by the black bar (right axis).

RT-PCR amplicons from any positive specimens aligned. Nucleotide and amino acid identity between the native replicase 1B region HCoV-HKU1 isolates and isolates New Haven both> 95%. Polymorphism rare (<1% of the order) recorded in HCoV-HKU1 sequences of isolates New Haven (data not shown), indicating that a single strain circulating in the community during the study period.

We report the first identification of HCoV-HKU1 in the Western Hemisphere. These findings suggest that HCoV-HKU1 may have worldwide distribution. We detect the coronavirus is within 1% of children screened. All samples HCoV-HKU1-positive tested negative for RSV, influenza virus, parainfluenza virus, adenovirus, HCoV-NH, and human metapneumovirus. Our laboratory does not have access to materials from Hong Kong; Therefore, the results can not represent contamination of laboratory material obtained elsewhere. The percentage of positive specimens was similar to that described by Woo et al. (1 [12:25%] of 400) () and Sloots et al. (10 [3.1%] of 324) (), which indicates that HCoV-HKU1 infection may rarely or that the virus has properties that decrease the likelihood of detection, such as a brief period of viral shedding. Our research, studies by Sloots et al., and the original study by Woo et al. filtered respiratory specimens submitted to a diagnostic laboratory. Therefore, HKU1 common virus might cause disease symptoms in only a relatively small percentage of people infected. All specimens HCoV-HKU1-positive were collected from December 2001 until February 2002, which means that the distribution of winter. Research by Sloots et al. also detected HCoV-HKU1 especially in winter, although respiratory samples submitted only during the winter months filtered. Is the seasonal distribution of HCoV-HKU1 varies from year to year is not known.

Similar to the patient described by Woo et al., Some patients HCoV-HKU1-positive evidence of the involvement of the lower respiratory tract (2 patients with pneumonia and one patient with bronchiolitis). Two of these patients had underlying disease. However, most patients identified in our study hAds only mild symptoms of upper respiratory tract. HCoV-HKU1 Most infections in children, similar to other common HCoV infection, the result is likely a mild illness (). Research Australia did a detailed clinical review of patients HCoV-HKU1-positive, but the authors noted that the symptoms consistent with acute respiratory disease () .the severity of disease caused by SARS-CoV in children is relatively light for reasons yet understood (). Underlying disease and preexisting lung disease could predispose to more severe clinical course.

Evidence of hepatitis in 1 positive children HCoV-HKU1 is interesting findings. HCoV-HKU1 most closely associated with murine hepatitis virus, the virus that causes hepatitis and demyelinating disease in mice (). Because the medical history of the patients (liver transplant) and a compromised immune status, many potential causes of hepatitis are there, even though serology and liver biopsy findings were unrevealing. Several reports have found the coronavirus-like particles in the stool of people with gastrointestinal disease (), which indicates that this virus, such as animal coronaviruses can cause diseases of the gastrointestinal tract. Future studies will be needed to determine whether HCoV-HKU1, or other common human coronavirus, play a role in heart disease.

Our study has several limitations. We limited screening for respiratory specimens collected at the discretion of the medical team, we did not include a control group of children without symptoms, and serum samples were not available for serology. Nonetheless, our findings suggest that HCoV-HKU1 circulated in New Haven, Connecticut, and is associated with both diseases upper and lower respiratory and lung diseases may.

HCoV-HKU1 genetic variability is unknown. Research by Sloots et al. 2 shows genotype when comparing isolates Australia to Hong Kong prototype strain (). If multiple genotypes exist, they may not all be detected with the primer sets used. This limitation will result in an understatement of this virus in our study. However, the area replicase 1B gene targeted by the primers used () is highly conserved among other coronavirus, and our screening are unlikely to have a lack of sensitivity for that reason. Also, only a rare polymorphisms were detected in 9 isolates individual sequence analyzes, which show that this region is highly conserved. However, in order to establish the true prevalence HKU1, primary usage with known specificity and sensitivity for HCoV-HKU1 will be important.

In conclusion, we demonstrated that circulating HCoV-HKU1 in the United States, and the yeast strain identified in New Haven are similar to native species described from Hong Kong. Is this newly recognized pathogen responsible for most of respiratory diseases in children remains to be determined. Future studies are needed to determine the epidemiology and clinical spectrum features of this newly recognized pathogen.

We are indebted to George Miller to support and critical review of this work, Eugene D. Shapiro for his review of the manuscript, and the staff of the clinical virology laboratory at the Hospital at Yale-New Haven for their assistance in collecting specimens clinical.

This work was supported by the Patrick and Catherine Weldon DONAGHUE Medical Research Foundation. This work was also supported in part by the Friends of Yale Pediatrics (J.S.K.); Yale Children’s Clinical Research Center provides M01-RR06022; General Clinical Research Centers Program, National Center for Research Resources, National Institutes of Health; and the National Institutes of Health grant T32 AI07210-20 (F.E.).

Dr. Esper is an assistant professor in the Department of Pediatrics, Division of Infectious Diseases, Case Western Reserve University. His research interests are in the epidemiology and molecular biology are recognized and emerging new respiratory virus

Suggested citation for this article :. Esper F, Weibel C, Ferguson D, Landry ML, Kahn JS. HKU1 coronavirus infection in the United States. Emerg Infect Dis [serial on the Internet]. April 2006 [date cited].

,

8600 Rockville Pike, Bethesda
MD, 20 894
United States of America

Identifying and Managing Coronavirus in the ED EMRA
Identifying and Managing Coronavirus in the ED EMRA

Revisiting the dangers of the coronavirus in the ophthalmology ...
Revisiting the dangers of the coronavirus in the ophthalmology …

Frontiers | Recent Aspects on the Pathogenesis Mechanism, Animal ...
Frontiers | Recent Aspects on the Pathogenesis Mechanism, Animal …

Two Miami University students being tested for coronavirus, flu ...
Two Miami University students being tested for coronavirus, flu …

Experts envision two scenarios if the new coronavirus isn
Experts envision two scenarios if the new coronavirus isn’t …

What the latest coronavirus tells us about emerging new infections
What the latest coronavirus tells us about emerging new infections

Coronavirus HKU1 infection in the United States.
Coronavirus HKU1 infection in the United States.

First Case of 2019 Novel Coronavirus in the United States | NEJM
First Case of 2019 Novel Coronavirus in the United States | NEJM

Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar ...
Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar …

Middle East respiratory syndrome coronavirus: transmission ...
Middle East respiratory syndrome coronavirus: transmission …

Severe acute respiratory syndrome coronavirus 2 - Wikipedia
Severe acute respiratory syndrome coronavirus 2 – Wikipedia

Coronavirus Symptoms and How to Protect Yourself: What We Know - WSJ
Coronavirus Symptoms and How to Protect Yourself: What We Know – WSJ

First Death In China From New Coronavirus Pneumonia Outbreak
First Death In China From New Coronavirus Pneumonia Outbreak

MU students react to U.S. spread of the deadly Wuhan coronavirus ...
MU students react to U.S. spread of the deadly Wuhan coronavirus …

Revisiting the dangers of the coronavirus in the ophthalmology ...
Revisiting the dangers of the coronavirus in the ophthalmology …

Explainer: What is a coronavirus? | Science News for Students
Explainer: What is a coronavirus? | Science News for Students

How the new coronavirus stacks up against SARS and MERS | Science News
How the new coronavirus stacks up against SARS and MERS | Science News

The Novel Human Coronaviruses NL63 and HKU1 | Journal of Virology
The Novel Human Coronaviruses NL63 and HKU1 | Journal of Virology

2019 Novel Coronavirus (2019-nCoV) Update: Uncoating the Virus
2019 Novel Coronavirus (2019-nCoV) Update: Uncoating the Virus

Coronavirus Symptoms and How to Protect Yourself: What We Know - WSJ
Coronavirus Symptoms and How to Protect Yourself: What We Know – WSJ

Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar ...
Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar …

Everything you need to know as the China coronavirus spreads - Los ...
Everything you need to know as the China coronavirus spreads – Los …

About Coronavirus Disease 2019 (COVID-19) | CDC
About Coronavirus Disease 2019 (COVID-19) | CDC

Experts envision two scenarios if new coronavirus isn
Experts envision two scenarios if new coronavirus isn’t contained …

City of Norco Website - News Details
City of Norco Website – News Details

PDF) Coronavirus HKU1 Infection in the United States
PDF) Coronavirus HKU1 Infection in the United States

Broad-spectrum coronavirus antiviral drug discovery: Expert ...
Broad-spectrum coronavirus antiviral drug discovery: Expert …

How the new coronavirus stacks up against SARS and MERS | Science News
How the new coronavirus stacks up against SARS and MERS | Science News

CDC reminds clinicians to use standard precautions, recommends ...
CDC reminds clinicians to use standard precautions, recommends …

Experts envision two scenarios if new coronavirus isn
Experts envision two scenarios if new coronavirus isn’t contained …

William Blair Commentary: Coronavirus Shakes Markets--Likely ...
William Blair Commentary: Coronavirus Shakes Markets–Likely …

Viruses | Free Full-Text | Human Coronavirus Infections in Israel ...
Viruses | Free Full-Text | Human Coronavirus Infections in Israel …

Epidemiology characteristics of human coronaviruses in patients ...
Epidemiology characteristics of human coronaviruses in patients …

13 Coronavirus myths busted by science | Live Science
13 Coronavirus myths busted by science | Live Science

Coronavirus
Coronavirus

How Do Animal Viruses Like Coronavirus Jump Species? | Quanta Magazine
How Do Animal Viruses Like Coronavirus Jump Species? | Quanta Magazine

Coronavirus Disease 2019 (COVID-19): A New Pandemic?
Coronavirus Disease 2019 (COVID-19): A New Pandemic?

New coronavirus is
New coronavirus is ‘a pandemic,’ expert says — here’s how it could …

First Death In China From New Coronavirus Pneumonia Outbreak
First Death In China From New Coronavirus Pneumonia Outbreak

Coronavirus: Symptoms, testing and how to prepare amid growing ...
Coronavirus: Symptoms, testing and how to prepare amid growing …

Clinical features of patients infected with 2019 novel coronavirus ...
Clinical features of patients infected with 2019 novel coronavirus …

7 human coronavirus types: What are the differences?
7 human coronavirus types: What are the differences?

2012 Middle East respiratory syndrome coronavirus outbreak - Wikipedia
2012 Middle East respiratory syndrome coronavirus outbreak – Wikipedia

Coronavirus FAQs | City of Glendale, CA
Coronavirus FAQs | City of Glendale, CA

A Novel Coronavirus from Patients with Pneumonia in China, 2019 | NEJM
A Novel Coronavirus from Patients with Pneumonia in China, 2019 | NEJM

Nowcasting and forecasting the potential domestic and ...
Nowcasting and forecasting the potential domestic and …

The U.K.
The U.K.’s Coronavirus ‘Herd Immunity’ Debacle – The Atlantic

Middle East Respiratory Syndrome Coronavirus: Another Zoonotic ...
Middle East Respiratory Syndrome Coronavirus: Another Zoonotic …

New Recommendations for Health Care Providers: 2019 Novel Coronavirus
New Recommendations for Health Care Providers: 2019 Novel Coronavirus

Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar ...
Human Coronavirus HKU1 Infection of Primary Human Type II Alveolar …

China
China’s Deadly Coronavirus Cover-Up Is Getting Worse as First Case …

Coronavirus in Kentucky: What to know about masks, symptoms and more
Coronavirus in Kentucky: What to know about masks, symptoms and more

Coronavirus in Wuhan, China, may become seasonal illness like the flu
Coronavirus in Wuhan, China, may become seasonal illness like the flu

Coronavirus Syracuse, New York (NY), St. Joseph
Coronavirus Syracuse, New York (NY), St. Joseph’s Health

Tinggalkan Balasan

Alamat email Anda tidak akan dipublikasikan. Ruas yang wajib ditandai *